Flawfinder version 2.0.10, (C) 2001-2019 David A. Wheeler. Number of rules (primarily dangerous function names) in C/C++ ruleset: 223 Examining data/segemehl-0.3.4/libs/md5.c Examining data/segemehl-0.3.4/libs/vstack.c Examining data/segemehl-0.3.4/libs/queryalign.c Examining data/segemehl-0.3.4/libs/annotation.c Examining data/segemehl-0.3.4/libs/biofiles.c Examining data/segemehl-0.3.4/libs/bitVector.c Examining data/segemehl-0.3.4/libs/locus.c Examining data/segemehl-0.3.4/libs/seqclip.c Examining data/segemehl-0.3.4/libs/debug.c Examining data/segemehl-0.3.4/libs/merge.c Examining data/segemehl-0.3.4/libs/kdseed.c Examining data/segemehl-0.3.4/libs/stack.c Examining data/segemehl-0.3.4/libs/bamio.c Examining data/segemehl-0.3.4/libs/vqueue.c Examining data/segemehl-0.3.4/libs/aluruSort.c Examining data/segemehl-0.3.4/libs/segemehl_helper.c Examining data/segemehl-0.3.4/libs/bitArray.c Examining data/segemehl-0.3.4/libs/samheader.c Examining data/segemehl-0.3.4/libs/sw.c Examining data/segemehl-0.3.4/libs/fileio.c Examining data/segemehl-0.3.4/libs/kdchain.c Examining data/segemehl-0.3.4/libs/vtprogressbar.c Examining data/segemehl-0.3.4/libs/karlin.c Examining data/segemehl-0.3.4/libs/bgzip.c Examining data/segemehl-0.3.4/libs/gzidx.c Examining data/segemehl-0.3.4/libs/portable_endian.c Examining data/segemehl-0.3.4/libs/container.c Examining data/segemehl-0.3.4/libs/bedfiles.c Examining data/segemehl-0.3.4/libs/segemehl.c Examining data/segemehl-0.3.4/libs/memory.c Examining data/segemehl-0.3.4/libs/junctions.c Examining data/segemehl-0.3.4/libs/pigeon.c Examining data/segemehl-0.3.4/libs/radixsort.c Examining data/segemehl-0.3.4/libs/sort.c Examining data/segemehl-0.3.4/libs/match.c Examining data/segemehl-0.3.4/libs/charsequence.c Examining data/segemehl-0.3.4/libs/stringutils.c Examining data/segemehl-0.3.4/libs/samio.c Examining data/segemehl-0.3.4/libs/manout.c Examining data/segemehl-0.3.4/libs/brendel.c Examining data/segemehl-0.3.4/libs/info.c Examining data/segemehl-0.3.4/libs/gzip.c Examining data/segemehl-0.3.4/libs/sufarray.c Examining data/segemehl-0.3.4/libs/fileBins.c Examining data/segemehl-0.3.4/libs/splitalign.c Examining data/segemehl-0.3.4/libs/iupac.c Examining data/segemehl-0.3.4/libs/bitvectoralg.c Examining data/segemehl-0.3.4/libs/intervaltree.c Examining data/segemehl-0.3.4/libs/haarz.c Examining data/segemehl-0.3.4/libs/manopt.c Examining data/segemehl-0.3.4/libs/mathematics.c Examining data/segemehl-0.3.4/libs/multicharseq.c Examining data/segemehl-0.3.4/libs/filebuffer.c Examining data/segemehl-0.3.4/libs/mapfrag.c Examining data/segemehl-0.3.4/libs/mappingqual.c Examining data/segemehl-0.3.4/libs/nw.c Examining data/segemehl-0.3.4/libs/alignment.c Examining data/segemehl-0.3.4/libs/matealign.c Examining data/segemehl-0.3.4/include/segemehl_helper.h Examining data/segemehl-0.3.4/include/charsequence.h Examining data/segemehl-0.3.4/include/mmchar.h Examining data/segemehl-0.3.4/include/fileio.h Examining data/segemehl-0.3.4/include/iupac.h Examining data/segemehl-0.3.4/include/sw.h Examining data/segemehl-0.3.4/include/manoutformats.h Examining data/segemehl-0.3.4/include/vtprogressbar.h Examining data/segemehl-0.3.4/include/karlin.h Examining data/segemehl-0.3.4/include/stringutils.h Examining data/segemehl-0.3.4/include/fileBins.h Examining data/segemehl-0.3.4/include/sufarray.h Examining data/segemehl-0.3.4/include/match.h Examining data/segemehl-0.3.4/include/alignment.h Examining data/segemehl-0.3.4/include/bitvectoralg.h Examining data/segemehl-0.3.4/include/samio.h Examining data/segemehl-0.3.4/include/intervaltree.h Examining data/segemehl-0.3.4/include/pigeon.h Examining data/segemehl-0.3.4/include/matealign.h Examining data/segemehl-0.3.4/include/memory.h Examining data/segemehl-0.3.4/include/kdchain.h Examining data/segemehl-0.3.4/include/radixsort.h Examining data/segemehl-0.3.4/include/portable_endian.h Examining data/segemehl-0.3.4/include/matchfiles.h Examining data/segemehl-0.3.4/include/annotation.h Examining data/segemehl-0.3.4/include/queryalign.h Examining data/segemehl-0.3.4/include/vstack.h Examining data/segemehl-0.3.4/include/kdseed.h Examining data/segemehl-0.3.4/include/md5.h Examining data/segemehl-0.3.4/include/sort.h Examining data/segemehl-0.3.4/include/matchfilesfields.h Examining data/segemehl-0.3.4/include/mathematics.h Examining data/segemehl-0.3.4/include/vqueue.h Examining data/segemehl-0.3.4/include/mappingqual.h Examining data/segemehl-0.3.4/include/seqclip.h Examining data/segemehl-0.3.4/include/multicharseq.h Examining data/segemehl-0.3.4/include/haarz.h Examining data/segemehl-0.3.4/include/gzip.h Examining data/segemehl-0.3.4/include/info.h Examining data/segemehl-0.3.4/include/manopt.h Examining data/segemehl-0.3.4/include/bamio.h Examining data/segemehl-0.3.4/include/stack.h Examining data/segemehl-0.3.4/include/mapfrag.h Examining data/segemehl-0.3.4/include/biofiles.h Examining data/segemehl-0.3.4/include/bitArray.h Examining data/segemehl-0.3.4/include/locus.h Examining data/segemehl-0.3.4/include/filebuffer.h Examining data/segemehl-0.3.4/include/container.h Examining data/segemehl-0.3.4/include/junctions.h Examining data/segemehl-0.3.4/include/basic-types.h Examining data/segemehl-0.3.4/include/merge.h Examining data/segemehl-0.3.4/include/debug.h Examining data/segemehl-0.3.4/include/bitVector.h Examining data/segemehl-0.3.4/include/nw.h Examining data/segemehl-0.3.4/include/brendel.h Examining data/segemehl-0.3.4/include/manout.h Examining data/segemehl-0.3.4/include/falphabet.h Examining data/segemehl-0.3.4/include/aluruSort.h Examining data/segemehl-0.3.4/include/citation.h Examining data/segemehl-0.3.4/include/gzidx.h Examining data/segemehl-0.3.4/include/version.h Examining data/segemehl-0.3.4/include/bgzip.h Examining data/segemehl-0.3.4/include/samheader.h Examining data/segemehl-0.3.4/include/splitalign.h Examining data/segemehl-0.3.4/include/bedfiles.h Examining data/segemehl-0.3.4/include/segemehl.h FINAL RESULTS: data/segemehl-0.3.4/include/biofiles.h:116:10: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. struct access **gzindex; data/segemehl-0.3.4/include/biofiles.h:117:10: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. struct access **mategzindex; data/segemehl-0.3.4/include/biofiles.h:189:78: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. fasta_t* bl_fastxgzRead (void *space, fasta_t *fasta, char *filename, struct access *idx, data/segemehl-0.3.4/include/biofiles.h:218:76: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. fastxseqindex_t* bl_fastxChunkIndex (void *space, char **filenames, struct access **gzindex, data/segemehl-0.3.4/include/gzidx.h:138:16: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. typedef struct access { data/segemehl-0.3.4/include/gzidx.h:148:10: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. struct access *index; data/segemehl-0.3.4/include/gzidx.h:157:24: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. void free_index(struct access *index); data/segemehl-0.3.4/include/gzidx.h:173:53: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. struct gzidxfile* bl_initgzidxfile(FILE *fp, struct access *index, off_t offset, int len); data/segemehl-0.3.4/include/matchfiles.h:254:10: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. struct access *gzindex; data/segemehl-0.3.4/libs/biofiles.c:1508:3: [4] (buffer) strcpy: Does not check for buffer overflows when copying to destination [MS-banned] (CWE-120). Consider using snprintf, strcpy_s, or strlcpy (warning: strncpy easily misused). strcpy(id, desc); data/segemehl-0.3.4/libs/biofiles.c:1509:3: [4] (buffer) strcpy: Does not check for buffer overflows when copying to destination [MS-banned] (CWE-120). Consider using snprintf, strcpy_s, or strlcpy (warning: strncpy easily misused). strcpy(id2, mateid); data/segemehl-0.3.4/libs/biofiles.c:1522:5: [4] (buffer) strcpy: Does not check for buffer overflows when copying to destination [MS-banned] (CWE-120). Consider using snprintf, strcpy_s, or strlcpy (warning: strncpy easily misused). strcpy(id, desc); data/segemehl-0.3.4/libs/biofiles.c:1523:5: [4] (buffer) strcpy: Does not check for buffer overflows when copying to destination [MS-banned] (CWE-120). Consider using snprintf, strcpy_s, or strlcpy (warning: strncpy easily misused). strcpy(id2, mateid); data/segemehl-0.3.4/libs/biofiles.c:1914:28: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. char *filename, struct access *index, data/segemehl-0.3.4/libs/biofiles.c:2100:59: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. bl_fastxChunkIndex (void *space, char **filenames, struct access **gzindex, data/segemehl-0.3.4/libs/biofiles.c:2369:10: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. struct access **gzindex = NULL; data/segemehl-0.3.4/libs/biofiles.c:2375:47: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. gzindex = ALLOCMEMORY(space, NULL, struct access*, nooffiles); data/segemehl-0.3.4/libs/biofiles.c:2532:10: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. struct access * index = NULL; data/segemehl-0.3.4/libs/biofiles.c:2709:69: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. bl_fastxgzRead (void *space, fasta_t *fasta, char *filename, struct access *idx, data/segemehl-0.3.4/libs/biofiles.c:2955:10: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. struct access *gzindex; data/segemehl-0.3.4/libs/biofiles.c:3032:10: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. struct access *gzindex; data/segemehl-0.3.4/libs/debug.c:63:10: [4] (format) vfprintf: If format strings can be influenced by an attacker, they can be exploited (CWE-134). Use a constant for the format specification. ret = vfprintf(dbgdevice, fmt, ap); data/segemehl-0.3.4/libs/debug.c:102:11: [4] (format) vfprintf: If format strings can be influenced by an attacker, they can be exploited (CWE-134). Use a constant for the format specification. ret = vfprintf(dbgdevice, fmt, ap); data/segemehl-0.3.4/libs/fileBins.c:691:5: [4] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. sprintf(newname, "%s_%s.%s", bname, ccname, suf); data/segemehl-0.3.4/libs/fileBins.c:1032:7: [4] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. sprintf(newname, "%s_%s.%s", bname, ccname, suf); data/segemehl-0.3.4/libs/fileio.c:163:5: [4] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. sprintf(fname, "%s/%sXXXXXX", path, tmp); data/segemehl-0.3.4/libs/fileio.c:165:5: [4] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. sprintf(fname,"%s/XXXXXX", path); data/segemehl-0.3.4/libs/fileio.c:205:3: [4] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. sprintf(cmd, "%s -m -t '%c' %s %s > %s", prg, delim, fieldstring, filenamestring, outfile); data/segemehl-0.3.4/libs/fileio.c:206:9: [4] (shell) system: This causes a new program to execute and is difficult to use safely (CWE-78). try using a library call that implements the same functionality if available. ret = system(cmd); data/segemehl-0.3.4/libs/fileio.c:219:3: [4] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. sprintf(cmd, "%s -f %s", prg, filename); data/segemehl-0.3.4/libs/fileio.c:220:3: [4] (shell) system: This causes a new program to execute and is difficult to use safely (CWE-78). try using a library call that implements the same functionality if available. system(cmd); data/segemehl-0.3.4/libs/fileio.c:356:9: [4] (shell) system: This causes a new program to execute and is difficult to use safely (CWE-78). try using a library call that implements the same functionality if available. ret = system(cmd); data/segemehl-0.3.4/libs/fileio.c:376:11: [4] (shell) system: This causes a new program to execute and is difficult to use safely (CWE-78). try using a library call that implements the same functionality if available. ret = system(cmd2); data/segemehl-0.3.4/libs/gzidx.c:137:24: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. void free_index(struct access *index) data/segemehl-0.3.4/libs/gzidx.c:156:21: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. index = (struct access *)malloc(sizeof(struct access)); data/segemehl-0.3.4/libs/gzidx.c:156:51: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. index = (struct access *)malloc(sizeof(struct access)); data/segemehl-0.3.4/libs/gzidx.c:295:10: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. struct access *index; /* access points being generated */ data/segemehl-0.3.4/libs/gzidx.c:879:35: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. bl_initgzidxfile(FILE *fp, struct access *index, off_t offset, int mychunk) data/segemehl-0.3.4/libs/info.c:95:10: [4] (format) vfprintf: If format strings can be influenced by an attacker, they can be exploited (CWE-134). Use a constant for the format specification. ret = vfprintf(nfodevice, fmt, ap); data/segemehl-0.3.4/libs/info.c:141:11: [4] (format) vfprintf: If format strings can be influenced by an attacker, they can be exploited (CWE-134). Use a constant for the format specification. ret = vfprintf(nfodevice, fmt, ap); data/segemehl-0.3.4/libs/manopt.c:59:3: [4] (buffer) strcpy: Does not check for buffer overflows when copying to destination [MS-banned] (CWE-120). Consider using snprintf, strcpy_s, or strlcpy (warning: strncpy easily misused). strcpy(src, version); data/segemehl-0.3.4/libs/manopt.c:74:3: [4] (buffer) strcpy: Does not check for buffer overflows when copying to destination [MS-banned] (CWE-120). Consider using snprintf, strcpy_s, or strlcpy (warning: strncpy easily misused). strcpy(p, version); data/segemehl-0.3.4/libs/manopt.c:152:3: [4] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). strcat(call, set->call); data/segemehl-0.3.4/libs/manopt.c:170:7: [4] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). strcat(synopsis, string); data/segemehl-0.3.4/libs/manopt.c:184:7: [4] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). strcat(arg[aptr], set->opts[i].longopt); data/segemehl-0.3.4/libs/manopt.c:201:9: [4] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). strcat(synopsis, string); data/segemehl-0.3.4/libs/manopt.c:202:9: [4] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). strcat(arg[aptr],string); data/segemehl-0.3.4/libs/manopt.c:209:9: [4] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). strcat(arg[aptr], longopt); data/segemehl-0.3.4/libs/manopt.c:212:11: [4] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). strcat(synopsis, longopt); data/segemehl-0.3.4/libs/manopt.c:218:9: [4] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). strcat(arg[aptr], set->opts[i].argdesc); data/segemehl-0.3.4/libs/manopt.c:220:9: [4] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). strcat(synopsis, set->opts[i].argdesc); data/segemehl-0.3.4/libs/manopt.c:224:7: [4] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). strcat(msg[aptr], set->opts[i].helpmsg); data/segemehl-0.3.4/libs/manopt.c:227:9: [4] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). strcat(msg[aptr], set->opts[i].defaultval); data/segemehl-0.3.4/libs/manopt.c:243:7: [4] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). strcat(arg[aptr], string); data/segemehl-0.3.4/libs/manopt.c:247:9: [4] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). strcat(arg[aptr], longopt); data/segemehl-0.3.4/libs/manopt.c:250:7: [4] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). strcat(msg[aptr], set->opts[i].helpmsg); data/segemehl-0.3.4/libs/manopt.c:256:5: [4] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). strcat(synopsis, set->unflagged); data/segemehl-0.3.4/libs/manopt.c:378:3: [4] (format) vfprintf: If format strings can be influenced by an attacker, they can be exploited (CWE-134). Use a constant for the format specification. vfprintf(stderr, fmt, ap); data/segemehl-0.3.4/libs/manopt.c:589:11: [4] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. sprintf(set->opts[i].defaultval, "\"%s\"", ptr[0]); data/segemehl-0.3.4/libs/merge.c:462:3: [4] (buffer) strcpy: Does not check for buffer overflows when copying to destination [MS-banned] (CWE-120). Consider using snprintf, strcpy_s, or strlcpy (warning: strncpy easily misused). strcpy(id, desc1); data/segemehl-0.3.4/libs/merge.c:463:3: [4] (buffer) strcpy: Does not check for buffer overflows when copying to destination [MS-banned] (CWE-120). Consider using snprintf, strcpy_s, or strlcpy (warning: strncpy easily misused). strcpy(id2, desc2); data/segemehl-0.3.4/libs/merge.c:476:5: [4] (buffer) strcpy: Does not check for buffer overflows when copying to destination [MS-banned] (CWE-120). Consider using snprintf, strcpy_s, or strlcpy (warning: strncpy easily misused). strcpy(id, desc1); data/segemehl-0.3.4/libs/merge.c:477:5: [4] (buffer) strcpy: Does not check for buffer overflows when copying to destination [MS-banned] (CWE-120). Consider using snprintf, strcpy_s, or strlcpy (warning: strncpy easily misused). strcpy(id2, desc2); data/segemehl-0.3.4/libs/samheader.c:477:10: [4] (race) access: This usually indicates a security flaw. If an attacker can change anything along the path between the call to access() and the file's actual use (e.g., by moving files), the attacker can exploit the race condition (CWE-362/CWE-367!). Set up the correct permissions (e.g., using setuid()) and try to open the file directly. struct access * index = NULL; data/segemehl-0.3.4/libs/samio.c:499:9: [4] (format) vsnprintf: If format strings can be influenced by an attacker, they can be exploited, and note that sprintf variations do not always \0-terminate (CWE-134). Use a constant for the format specification. len = vsnprintf(NULL, 0, fmt, ap); data/segemehl-0.3.4/libs/samio.c:505:3: [4] (format) vsprintf: Potential format string problem (CWE-134). Make format string constant. vsprintf(xval, fmt, ap); data/segemehl-0.3.4/libs/stringutils.c:471:20: [4] (buffer) strcpy: Does not check for buffer overflows when copying to destination [MS-banned] (CWE-120). Consider using snprintf, strcpy_s, or strlcpy (warning: strncpy easily misused). if (d != NULL) strcpy (d,s); // Copy string if okay data/segemehl-0.3.4/libs/stringutils.c:493:9: [4] (format) vsnprintf: If format strings can be influenced by an attacker, they can be exploited, and note that sprintf variations do not always \0-terminate (CWE-134). Use a constant for the format specification. len = vsnprintf(NULL, 0, fmt, ap); data/segemehl-0.3.4/libs/stringutils.c:501:9: [4] (format) vsprintf: Potential format string problem (CWE-134). Make format string constant. len = vsprintf(tmp, fmt, ap); data/segemehl-0.3.4/libs/stringutils.c:518:9: [4] (format) vsnprintf: If format strings can be influenced by an attacker, they can be exploited, and note that sprintf variations do not always \0-terminate (CWE-134). Use a constant for the format specification. len = vsnprintf(NULL, 0, fmt, ap); data/segemehl-0.3.4/libs/stringutils.c:526:9: [4] (format) vsprintf: Potential format string problem (CWE-134). Make format string constant. len = vsprintf(tmp, fmt, ap); data/segemehl-0.3.4/include/citation.h:65:4: [3] (random) srand: This function is not sufficiently random for security-related functions such as key and nonce creation (CWE-327). Use a more secure technique for acquiring random values. srand(time(NULL)); data/segemehl-0.3.4/libs/seqclip.c:622:5: [3] (random) srand: This function is not sufficiently random for security-related functions such as key and nonce creation (CWE-327). Use a more secure technique for acquiring random values. srand(time(NULL)); data/segemehl-0.3.4/include/gzidx.h:134:14: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. unsigned char window[WINSIZE]; /* preceding 32K of uncompressed data */ data/segemehl-0.3.4/include/gzip.h:21:5: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. char extraBytes[MAX_XTRA_BYTES]; data/segemehl-0.3.4/libs/alignment.c:821:5: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(&meopstr[cur+1], "%d;", steps); data/segemehl-0.3.4/libs/alignment.c:841:13: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(&meopstr[cur+1], "%d;", msteps); data/segemehl-0.3.4/libs/alignment.c:854:13: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(&meopstr[cur+1], "%d;", ssteps); data/segemehl-0.3.4/libs/alignment.c:914:5: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(&meopstr[cur+1], "%d;", steps); data/segemehl-0.3.4/libs/alignment.c:923:5: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(&meopstr[cur+1], "%d;", steps); data/segemehl-0.3.4/libs/alignment.c:953:13: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(&mdstr[cur], "%d", msteps); data/segemehl-0.3.4/libs/alignment.c:961:11: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(&mdstr[cur], "%c", al->v[j+q+al->voff]); data/segemehl-0.3.4/libs/alignment.c:987:9: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(&mdstr[cur], "%d", msteps); data/segemehl-0.3.4/libs/alignment.c:1001:9: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(&mdstr[cur], "%c", al->v[j+q+al->voff]); data/segemehl-0.3.4/libs/alignment.c:1037:5: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(&mdstr[cur], "%d", msteps); data/segemehl-0.3.4/libs/alignment.c:1070:40: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). string = realloc(string, allen+atoi(buffer)+1); data/segemehl-0.3.4/libs/alignment.c:1071:37: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). memset(&string[allen], 'S', atoi(buffer)); data/segemehl-0.3.4/libs/alignment.c:1072:18: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). allen += atoi(buffer); data/segemehl-0.3.4/libs/alignment.c:1073:15: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). upos+=atoi(buffer); data/segemehl-0.3.4/libs/alignment.c:1081:40: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). string = realloc(string, allen+atoi(buffer)+1); data/segemehl-0.3.4/libs/alignment.c:1082:37: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). memset(&string[allen], 'M', atoi(buffer)); data/segemehl-0.3.4/libs/alignment.c:1083:18: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). allen += atoi(buffer); data/segemehl-0.3.4/libs/alignment.c:1084:16: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). upos+= atoi(buffer); data/segemehl-0.3.4/libs/alignment.c:1085:16: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). vpos+= atoi(buffer); data/segemehl-0.3.4/libs/alignment.c:1091:40: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). string = realloc(string, allen+atoi(buffer)+1); data/segemehl-0.3.4/libs/alignment.c:1092:37: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). memset(&string[allen], 'D', atoi(buffer)); data/segemehl-0.3.4/libs/alignment.c:1093:18: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). allen += atoi(buffer); data/segemehl-0.3.4/libs/alignment.c:1094:15: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). vpos+=atoi(buffer); data/segemehl-0.3.4/libs/alignment.c:1100:40: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). string = realloc(string, allen+atoi(buffer)+1); data/segemehl-0.3.4/libs/alignment.c:1101:37: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). memset(&string[allen], 'I', atoi(buffer)); data/segemehl-0.3.4/libs/alignment.c:1102:18: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). allen += atoi(buffer); data/segemehl-0.3.4/libs/alignment.c:1103:17: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). upos += atoi(buffer); data/segemehl-0.3.4/libs/alignment.c:1113:17: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). vpos += atoi(buffer); data/segemehl-0.3.4/libs/alignment.c:1156:18: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). allen += atoi(buffer); data/segemehl-0.3.4/libs/alignment.c:1165:18: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). allen += atoi(buffer); data/segemehl-0.3.4/libs/alignment.c:1219:14: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). nops = atoi(buffer); data/segemehl-0.3.4/libs/alignment.c:1241:10: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). nops = atoi(buffer); data/segemehl-0.3.4/libs/alignment.c:1265:5: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(&cigarstr[cur], "%d%c", steps, clipch); data/segemehl-0.3.4/libs/alignment.c:1283:15: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(&cigarstr[cur], "%d%c", msteps, eopc); data/segemehl-0.3.4/libs/alignment.c:1291:15: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(&cigarstr[cur], "%d%c", msteps, eopc); data/segemehl-0.3.4/libs/alignment.c:1337:7: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(&cigarstr[cur], "%d%c", steps, eopc); data/segemehl-0.3.4/libs/alignment.c:1374:7: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(&cigarstr[cur], "%d%c", steps, eopc); data/segemehl-0.3.4/libs/alignment.c:1384:5: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(&cigarstr[cur], "%d%c", steps, clipch); data/segemehl-0.3.4/libs/bamio.c:64:16: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. const unsigned char seq_nt16_GHN_table[256] = { data/segemehl-0.3.4/libs/bamio.c:86:16: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. const unsigned char seq_nt16_C_context_table[3][3] = { data/segemehl-0.3.4/libs/bamio.c:92:7: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. const char seq_nt16_C_context_str[9][4] = {"CHH", "CHG", "CHN", "CGH", "CGG", "CGN", "CNH", "CNG", "CNN"}; data/segemehl-0.3.4/libs/bamio.c:94:7: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. const char seq_nt16_C_context_char[9] = {'h' , 'x', 'u', 'z', 'z', 'z', 'u', 'u', 'u'}; data/segemehl-0.3.4/libs/bamio.c:299:3: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. char ctxt[3]={0,0,0}; data/segemehl-0.3.4/libs/bedfiles.c:133:29: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). item->start = atoi(str); data/segemehl-0.3.4/libs/bedfiles.c:140:27: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). item->end = atoi(str); data/segemehl-0.3.4/libs/bedfiles.c:167:34: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). item->thickStart = atoi(str); data/segemehl-0.3.4/libs/bedfiles.c:174:32: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). item->thickEnd = atoi(str); data/segemehl-0.3.4/libs/bedfiles.c:185:36: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). item->itemRgb[k] = atoi(pch); data/segemehl-0.3.4/libs/bedfiles.c:203:34: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). item->blockCount = atoi(str); data/segemehl-0.3.4/libs/bedfiles.c:214:39: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). item->blockSizes[k] = atoi(pch); data/segemehl-0.3.4/libs/bedfiles.c:254:42: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). item->blockStarts[k] = atoi(tmp); data/segemehl-0.3.4/libs/bedfiles.c:264:42: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). item->blockStarts[k] = atoi(pch); data/segemehl-0.3.4/libs/bgzip.c:20:5: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. char buf[sizeof (BgzipRawHeader)]; data/segemehl-0.3.4/libs/bgzip.c:34:5: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. memcpy(u_bgzheader.buf, gzipHeader->extraBytes, sizeof (u_BgzipRawHeader)); data/segemehl-0.3.4/libs/bgzip.c:86:9: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. char buf[sizeof (uint32_t)]; data/segemehl-0.3.4/libs/biofiles.c:1937:10: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "rb"); data/segemehl-0.3.4/libs/biofiles.c:1948:10: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "r"); data/segemehl-0.3.4/libs/biofiles.c:2544:10: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "rb"); data/segemehl-0.3.4/libs/biofiles.c:2547:10: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "r"); data/segemehl-0.3.4/libs/biofiles.c:2739:8: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "rb"); data/segemehl-0.3.4/libs/biofiles.c:3370:8: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "w"); data/segemehl-0.3.4/libs/biofiles.c:3551:29: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). item->start = atoi(str); data/segemehl-0.3.4/libs/biofiles.c:3560:27: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). item->end = atoi(str); data/segemehl-0.3.4/libs/biofiles.c:3583:29: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). item->frame = atoi(str); data/segemehl-0.3.4/libs/charsequence.c:284:12: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). infile = fopen( filename, "r" ); data/segemehl-0.3.4/libs/charsequence.c:336:13: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). outfile = fopen (filename, "w"); data/segemehl-0.3.4/libs/debug.c:74:8: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "w"); data/segemehl-0.3.4/libs/fileBins.c:256:27: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). if (!bin->fp) bin->fp = fopen(bin->fname, mode); data/segemehl-0.3.4/libs/fileBins.c:743:17: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). outfile = fopen(newname,"w"); data/segemehl-0.3.4/libs/fileBins.c:748:15: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). outfile = fopen(newname, "ab"); data/segemehl-0.3.4/libs/fileBins.c:756:12: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(dms->domain[i].bins.b[j].fname, "rb"); data/segemehl-0.3.4/libs/fileBins.c:829:15: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). outfile = fopen(filename, "w"); data/segemehl-0.3.4/libs/fileBins.c:832:15: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). outfile = fopen(tmpname, "w"); data/segemehl-0.3.4/libs/fileBins.c:863:10: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(bins->b[i].fname, "r"); data/segemehl-0.3.4/libs/fileBins.c:937:17: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). outfile = fopen(tmpname, "w"); data/segemehl-0.3.4/libs/fileBins.c:970:13: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). outfile = fopen(filename, "w"); data/segemehl-0.3.4/libs/fileBins.c:972:10: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(bins->b[i].fname, "r"); data/segemehl-0.3.4/libs/filebuffer.c:332:5: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. memcpy(str, &cb->buffer[cb->beg], m); data/segemehl-0.3.4/libs/filebuffer.c:334:5: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. memcpy(str, &cb->buffer[cb->beg], cb->size-cb->beg); data/segemehl-0.3.4/libs/filebuffer.c:335:5: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. memcpy(&str[cb->size - cb->beg], cb->buffer, ell); data/segemehl-0.3.4/libs/fileio.c:85:9: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). out = fopen(tmpfilename, "w"); data/segemehl-0.3.4/libs/fileio.c:95:9: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). out = fopen(tmpfilename, "a"); data/segemehl-0.3.4/libs/fileio.c:96:8: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). in = fopen(filename, "r"); data/segemehl-0.3.4/libs/fileio.c:167:14: [2] (tmpfile) mkstemp: Potential for temporary file vulnerability in some circumstances. Some older Unix-like systems create temp files with permission to write by all by default, so be sure to set the umask to override this. Also, some older Unix systems might fail to use O_EXCL when opening the file, so make sure that O_EXCL is used by the library (CWE-377). if ((res = mkstemp(fname)) == -1) { data/segemehl-0.3.4/libs/fileio.c:418:8: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "rb+"); data/segemehl-0.3.4/libs/fileio.c:444:8: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "rb+"); data/segemehl-0.3.4/libs/fileio.c:476:8: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "rb+"); data/segemehl-0.3.4/libs/fileio.c:504:8: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "rb+"); data/segemehl-0.3.4/libs/fileio.c:558:8: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "r"); data/segemehl-0.3.4/libs/fileio.c:646:10: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). file = fopen(filename, "w"); data/segemehl-0.3.4/libs/fileio.c:665:10: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). file = fopen(filename, "w"); data/segemehl-0.3.4/libs/fileio.c:684:10: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). file = fopen(filename, "w"); data/segemehl-0.3.4/libs/fileio.c:707:10: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). file = fopen(filename, "w"); data/segemehl-0.3.4/libs/fileio.c:725:10: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). file = fopen(filename, "w"); data/segemehl-0.3.4/libs/gzidx.c:122:12: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. unsigned char output[WINSIZE+1]; data/segemehl-0.3.4/libs/gzidx.c:127:5: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. memcpy(output, window + WINSIZE - left, left); data/segemehl-0.3.4/libs/gzidx.c:129:5: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. memcpy(output + left, window, WINSIZE - left); data/segemehl-0.3.4/libs/gzidx.c:211:5: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. memcpy(next->window, window + WINSIZE - left, left); data/segemehl-0.3.4/libs/gzidx.c:213:5: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. memcpy(next->window + left, window, WINSIZE - left); data/segemehl-0.3.4/libs/gzidx.c:297:12: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. unsigned char input[CHUNK]; data/segemehl-0.3.4/libs/gzidx.c:298:12: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. unsigned char window[WINSIZE]; data/segemehl-0.3.4/libs/gzidx.c:300:8: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "rb"); data/segemehl-0.3.4/libs/gzidx.c:410:8: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "rb"); data/segemehl-0.3.4/libs/gzidx.c:506:5: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. memcpy(&buf[pos], window, cpysz); data/segemehl-0.3.4/libs/gzidx.c:571:12: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. unsigned char input[CHUNK]; data/segemehl-0.3.4/libs/gzidx.c:572:12: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. unsigned char discard[WINSIZE]; data/segemehl-0.3.4/libs/gzidx.c:678:12: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. unsigned char input[CHUNK]; data/segemehl-0.3.4/libs/gzidx.c:679:12: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. unsigned char wndw[WINSIZE]; data/segemehl-0.3.4/libs/gzidx.c:811:8: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "rb"); data/segemehl-0.3.4/libs/gzip.c:28:5: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. char buf[sizeof (CommonHeader)]; data/segemehl-0.3.4/libs/haarz.c:89:43: [2] (misc) open: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). if((!directionality && !start) || open || sep) { data/segemehl-0.3.4/libs/haarz.c:99:13: [2] (misc) open: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). if(!open || start || sep || closed) { data/segemehl-0.3.4/libs/haarz.c:124:13: [2] (misc) open: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). if(!open || start || !sep || closed) { data/segemehl-0.3.4/libs/haarz.c:488:15: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). outfp = fopen(outfn, "w"); data/segemehl-0.3.4/libs/haarz.c:629:15: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). outfp = fopen(outfn, "w"); data/segemehl-0.3.4/libs/info.c:52:18: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. static const char wday_name[7][3] = { data/segemehl-0.3.4/libs/info.c:57:18: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. static const char mon_name[12][3] = { data/segemehl-0.3.4/libs/info.c:62:12: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. static char result[26]; data/segemehl-0.3.4/libs/info.c:64:5: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(result, "%.3s %.3s%3d %.2d:%.2d:%.2d %d", data/segemehl-0.3.4/libs/info.c:106:8: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "w"); data/segemehl-0.3.4/libs/kdseed.c:703:5: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. memcpy(&data, tmp, sizeof(kdiffm_t)); data/segemehl-0.3.4/libs/kdseed.c:729:12: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. unsigned char a0[2] = {a[0] == NULL, a[1] == NULL}; data/segemehl-0.3.4/libs/kdseed.c:860:12: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. unsigned char a0[2] = {a[0] == NULL, a[1] == NULL}; data/segemehl-0.3.4/libs/kdseed.c:1178:5: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. memcpy(&data, tmp, sizeof(kmis_t)); data/segemehl-0.3.4/libs/manopt.c:127:3: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. char string[2]; data/segemehl-0.3.4/libs/manopt.c:151:3: [2] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant string. strcat(call, "usage: "); data/segemehl-0.3.4/libs/manopt.c:165:9: [2] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant string. strcat(synopsis, "[-"); data/segemehl-0.3.4/libs/manopt.c:175:5: [2] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant string. strcat(synopsis, "]\t"); data/segemehl-0.3.4/libs/manopt.c:183:7: [2] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant string. strcat(arg[aptr], " ["); data/segemehl-0.3.4/libs/manopt.c:208:9: [2] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant string. strcat(arg[aptr]," --"); data/segemehl-0.3.4/libs/manopt.c:211:11: [2] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant string. strcat(synopsis,"--"); data/segemehl-0.3.4/libs/manopt.c:226:9: [2] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant string. strcat(msg[aptr], " (default:"); data/segemehl-0.3.4/libs/manopt.c:233:9: [2] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant string. strcat(synopsis, "]\t"); data/segemehl-0.3.4/libs/manopt.c:245:9: [2] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant string. strcat(arg[aptr], ", "); data/segemehl-0.3.4/libs/manopt.c:246:9: [2] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant string. strcat(arg[aptr], "--"); data/segemehl-0.3.4/libs/manopt.c:555:10: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(set->opts[i].defaultval, "(%d,%d)", data/segemehl-0.3.4/libs/manopt.c:562:10: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(set->opts[i].defaultval, "(%d,%d,%d)", data/segemehl-0.3.4/libs/manopt.c:568:9: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(set->opts[i].defaultval, "%c", charval[0]); data/segemehl-0.3.4/libs/manopt.c:573:9: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(set->opts[i].defaultval, "%d", uintval[0]); data/segemehl-0.3.4/libs/manopt.c:578:9: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(set->opts[i].defaultval, "%d", intval[0]); data/segemehl-0.3.4/libs/manopt.c:583:9: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(set->opts[i].defaultval, "%f", dblval[0]); data/segemehl-0.3.4/libs/manopt.c:591:11: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(set->opts[i].defaultval, "none"); data/segemehl-0.3.4/libs/manopt.c:597:11: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(set->opts[i].defaultval, "[%d,%d]", data/segemehl-0.3.4/libs/manopt.c:604:11: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(set->opts[i].defaultval, "[%d,%d]", data/segemehl-0.3.4/libs/manopt.c:611:11: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(set->opts[i].defaultval, "[%f,%f]", data/segemehl-0.3.4/libs/manopt.c:755:22: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). (lintval=atoi(argset->args[arg].values[0])) == INT_MIN || data/segemehl-0.3.4/libs/manopt.c:786:22: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). (lintval=atoi(argset->args[arg].values[0])) < 0 || data/segemehl-0.3.4/libs/manopt.c:822:20: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). (lintval=atoi(argset->args[arg].values[0])) == INT_MIN || data/segemehl-0.3.4/libs/manopt.c:823:20: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). (rintval=atoi(argset->args[arg].values[1])) == INT_MIN ) { data/segemehl-0.3.4/libs/manopt.c:852:20: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). (lintval=atoi(argset->args[arg].values[0])) == INT_MIN || data/segemehl-0.3.4/libs/manopt.c:853:20: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). (rintval=atoi(argset->args[arg].values[1])) == INT_MIN || data/segemehl-0.3.4/libs/manopt.c:854:20: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). (rintval=atoi(argset->args[arg].values[2])) == INT_MIN ) { data/segemehl-0.3.4/libs/manopt.c:878:20: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). (lintval=atoi(argset->args[arg].values[0])) == INT_MIN || data/segemehl-0.3.4/libs/manopt.c:879:20: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). (rintval=atoi(argset->args[arg].values[1])) == INT_MIN || data/segemehl-0.3.4/libs/manopt.c:917:20: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). (lintval=atoi(argset->args[arg].values[0])) < 0 || data/segemehl-0.3.4/libs/manopt.c:918:20: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). (rintval=atoi(argset->args[arg].values[1])) < 0 || data/segemehl-0.3.4/libs/manopt.c:1102:30: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). *uintval = atoi(argset.args[j].values[0]); data/segemehl-0.3.4/libs/manopt.c:1107:29: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). *intval = atoi(argset.args[j].values[0]); data/segemehl-0.3.4/libs/manopt.c:1127:36: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). intrangeval[0] = atoi(argset.args[j].values[0]); data/segemehl-0.3.4/libs/manopt.c:1128:36: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). intrangeval[1] = atoi(argset.args[j].values[1]); data/segemehl-0.3.4/libs/manopt.c:1134:36: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). intrangeval[0] = atoi(argset.args[j].values[0]); data/segemehl-0.3.4/libs/manopt.c:1135:36: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). intrangeval[1] = atoi(argset.args[j].values[1]); data/segemehl-0.3.4/libs/manopt.c:1143:36: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). intrangeval[0] = atoi(argset.args[j].values[0]); data/segemehl-0.3.4/libs/manopt.c:1144:36: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). intrangeval[1] = atoi(argset.args[j].values[1]); data/segemehl-0.3.4/libs/manopt.c:1145:36: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). intrangeval[2] = atoi(argset.args[j].values[2]); data/segemehl-0.3.4/libs/manopt.c:1150:37: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). uintrangeval[0] = atoi(argset.args[j].values[0]); data/segemehl-0.3.4/libs/manopt.c:1151:37: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). uintrangeval[1] = atoi(argset.args[j].values[1]); data/segemehl-0.3.4/libs/manout.c:669:17: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). info->dev=fopen(info->outfn, "wb"); //w -> wb data/segemehl-0.3.4/libs/manout.c:738:27: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). info->multisplitdev = fopen(info->multisplitfilename, "wb"); data/segemehl-0.3.4/libs/manout.c:740:28: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). info->singlesplitdev = fopen(info->singlesplitfilename, "wb"); data/segemehl-0.3.4/libs/manout.c:742:27: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). info->transsplitdev = fopen(info->transsplitfilename, "wb"); data/segemehl-0.3.4/libs/match.c:325:3: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. char *seqs[2], *mateseqs[2], *quals[2], *matequals[2]; data/segemehl-0.3.4/libs/md5.c:57:18: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. static const char *const test[7] = { data/segemehl-0.3.4/libs/md5.c:220:2: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. memcpy(xbuf, data, 64); data/segemehl-0.3.4/libs/md5.c:371:2: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. memcpy(pms->buf + offset, p, copy); data/segemehl-0.3.4/libs/md5.c:385:2: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. memcpy(pms->buf, p, left); data/segemehl-0.3.4/libs/merge.c:178:10: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). tmpi = atoi(tag->val); data/segemehl-0.3.4/libs/merge.c:184:10: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). tmpj = atoi(tag->val); data/segemehl-0.3.4/libs/merge.c:333:15: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). edist = atoi(bl_samgetTag(list[i]->read, "NM")->val); data/segemehl-0.3.4/libs/merge.c:334:16: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). edist += atoi(bl_samgetTag(list[i]->mate, "NM")->val); data/segemehl-0.3.4/libs/merge.c:343:15: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). edist = atoi(bl_samgetTag(list[i]->read, "NM")->val); data/segemehl-0.3.4/libs/merge.c:344:16: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). edist += atoi(bl_samgetTag(list[i]->mate, "NM")->val); data/segemehl-0.3.4/libs/merge.c:371:15: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). edist = atoi(bl_samgetTag(list[i]->read, "NM")->val); data/segemehl-0.3.4/libs/merge.c:377:15: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). edist = atoi(bl_samgetTag(list[i]->mate, "NM")->val); data/segemehl-0.3.4/libs/merge.c:385:15: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). edist = atoi(bl_samgetTag(list[i]->read, "NM")->val); data/segemehl-0.3.4/libs/merge.c:393:15: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). edist = atoi(bl_samgetTag(list[i]->mate, "NM")->val); data/segemehl-0.3.4/libs/merge.c:506:48: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). if (tag == NULL || strcmp(tag->type, "i") || atoi(tag->val) < 0){ data/segemehl-0.3.4/libs/merge.c:511:13: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). matchid = atoi(tag->val); data/segemehl-0.3.4/libs/nw.c:278:17: [2] (misc) open: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). Uint n, int open, int ext, int close, Sint (*sub)(symtype, symtype, void*), data/segemehl-0.3.4/libs/nw.c:345:17: [2] (misc) open: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). Uint n, int open, int ext, int close, Sint (*sub)(symtype, symtype, void*), data/segemehl-0.3.4/libs/nw.c:387:47: [2] (misc) open: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). if(cur == MATRIX2D(A, ncol, (i-1), j) + open) { data/segemehl-0.3.4/libs/nw.c:398:47: [2] (misc) open: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). if(cur == MATRIX2D(B, ncol, i, (j-1)) + open) { data/segemehl-0.3.4/libs/pigeon.c:102:3: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. char *seqs[2]; data/segemehl-0.3.4/libs/pigeon.c:103:3: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. char *quals[2]; data/segemehl-0.3.4/libs/radixsort.c:85:20: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. if(toSort == src) memcpy(b, toSort, size*nelem); data/segemehl-0.3.4/libs/radixsort.c:136:20: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. if(toSort == src) memcpy(b, toSort, size*nelem); data/segemehl-0.3.4/libs/radixsort.c:183:20: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. if(toSort == src) memcpy(b, toSort, sizeof(Uint)*nelem); data/segemehl-0.3.4/libs/samheader.c:166:5: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(&hdr[strlen(hdr)-1], "%c", 29); data/segemehl-0.3.4/libs/samheader.c:488:10: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "rb"); data/segemehl-0.3.4/libs/samheader.c:492:10: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "r"); data/segemehl-0.3.4/libs/samio.c:224:11: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). rc = (atoi(tag->val)) ? 0 : 1; data/segemehl-0.3.4/libs/samio.c:265:11: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). rc = (atoi(tag->val)) ? 0 : 1; data/segemehl-0.3.4/libs/samio.c:1443:16: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). flag = atoi(cur); data/segemehl-0.3.4/libs/samio.c:1455:16: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). mapq = atoi(cur); data/segemehl-0.3.4/libs/samio.c:1543:3: [2] (buffer) char: Statically-sized arrays can be improperly restricted, leading to potential overflows or other issues (CWE-119!/CWE-120). Perform bounds checking, use functions that limit length, or ensure that the size is larger than the maximum possible length. char isChimeric[2] = {0,0}; data/segemehl-0.3.4/libs/segemehl.c:643:23: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). info.nomatchdev = fopen(info.nomatchname, "w"); data/segemehl-0.3.4/libs/splitalign.c:167:15: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). val = atoi(buffer); data/segemehl-0.3.4/libs/splitalign.c:170:60: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). allen += snprintf(&string[allen], vallen+1, "%dS", atoi(buffer)); data/segemehl-0.3.4/libs/splitalign.c:179:15: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). val = atoi(buffer); data/segemehl-0.3.4/libs/splitalign.c:182:61: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). allen += snprintf(&string[allen], vallen+1, "%d%c", atoi(buffer), op); data/segemehl-0.3.4/libs/splitalign.c:189:15: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). val = atoi(buffer); data/segemehl-0.3.4/libs/splitalign.c:192:60: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). allen += snprintf(&string[allen], vallen+1, "%dD", atoi(buffer)); data/segemehl-0.3.4/libs/splitalign.c:198:15: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). val = atoi(buffer); data/segemehl-0.3.4/libs/splitalign.c:201:60: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). allen += snprintf(&string[allen], vallen+1, "%dI", atoi(buffer)); data/segemehl-0.3.4/libs/splitalign.c:211:19: [2] (integer) atoi: Unless checked, the resulting number can exceed the expected range (CWE-190). If source untrusted, check both minimum and maximum, even if the input had no minus sign (large numbers can roll over into negative number; consider saving to an unsigned value if that is intended). myvpos += atoi(buffer)+1; data/segemehl-0.3.4/libs/stringutils.c:123:11: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. buffer = memcpy(buffer, toTokens, len+1); data/segemehl-0.3.4/libs/stringutils.c:139:43: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. set->strings[set->noofstrings-1].str = memcpy(set->strings[set->noofstrings-1].str, token, toklen); data/segemehl-0.3.4/libs/stringutils.c:426:3: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(tmp, "%d", n); data/segemehl-0.3.4/libs/stringutils.c:437:3: [2] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source has a constant maximum length. sprintf(tmp, "%u", n); data/segemehl-0.3.4/libs/sufarray.c:310:8: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(filename, "w"); data/segemehl-0.3.4/libs/sufarray.c:422:8: [2] (misc) fopen: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fp = fopen(idxfilename, "r"); data/segemehl-0.3.4/libs/sufarray.c:454:10: [2] (misc) open: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fd = open(idxfilename, O_RDONLY); data/segemehl-0.3.4/libs/sufarray.c:481:10: [2] (misc) open: Check when opening files - can an attacker redirect it (via symlinks), force the opening of special file type (e.g., device files), move things around to create a race condition, control its ancestors, or change its contents? (CWE-362). fd = open(idxfilename, O_RDONLY); data/segemehl-0.3.4/libs/sufarray.c:1158:5: [2] (buffer) memcpy: Does not check for buffer overflows when copying to destination (CWE-120). Make sure destination can always hold the source data. memcpy(&ival, tmp, sizeof(PairUint)); data/segemehl-0.3.4/include/brendel.h:46:34: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). Alignment* splicedaligndp (char *read, unsigned int m, char *genome, unsigned int n, gene_t **model); data/segemehl-0.3.4/include/brendel.h:49:37: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). Alignment* splicedaligndpopt (char *read, unsigned int m, char *genome, unsigned int n, gene_t **model, Uint a, Uint b, Uint l, Uint r); data/segemehl-0.3.4/include/manout.h:157:42: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). se_destructMatches(void *space, gread_t *read); data/segemehl-0.3.4/include/manout.h:217:42: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). Uint se_setMatches(void *space, gread_t *read, gmatchlist_t *list, Uint maxedist, segemehl_t *nfo, char rep); data/segemehl-0.3.4/include/merge.h:44:13: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). samrec_t *read; data/segemehl-0.3.4/include/stringutils.h:41:9: [1] (buffer) strncpy: Easily used incorrectly; doesn't always \0-terminate or check for invalid pointers [MS-banned] (CWE-120). strncpy(D,S,L);\ data/segemehl-0.3.4/libs/alignment.c:958:13: [1] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source is a constant character. sprintf(&mdstr[cur], "0"); data/segemehl-0.3.4/libs/alignment.c:991:9: [1] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source is a constant character. sprintf(&mdstr[cur], "0"); data/segemehl-0.3.4/libs/alignment.c:998:7: [1] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source is a constant character. sprintf(&mdstr[cur], "^"); data/segemehl-0.3.4/libs/alignment.c:1030:5: [1] (buffer) sprintf: Does not check for buffer overflows (CWE-120). Use sprintf_s, snprintf, or vsnprintf. Risk is low because the source is a constant character. sprintf(&mdstr[cur], "0"); data/segemehl-0.3.4/libs/alignment.c:1064:9: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). len = strlen(cigar); data/segemehl-0.3.4/libs/alignment.c:1148:9: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). len = strlen(cigar); data/segemehl-0.3.4/libs/alignment.c:1204:11: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). MDlen = strlen(MD); data/segemehl-0.3.4/libs/bamio.c:547:33: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). bl_circBufferAddSave(cb, msg, strlen(msg)); data/segemehl-0.3.4/libs/bamio.c:552:43: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). if(out) bl_circBufferAddSave(cb, out, strlen(out)); data/segemehl-0.3.4/libs/bamio.c:656:40: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). bl_circBufferAddSave(w->cb, out, strlen(out)); data/segemehl-0.3.4/libs/bamio.c:1155:16: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). kputsn(text, strlen(text), &str); data/segemehl-0.3.4/libs/bedfiles.c:72:24: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). track->filenamelen = strlen(filename); data/segemehl-0.3.4/libs/bedfiles.c:83:13: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). len = strlen(str); data/segemehl-0.3.4/libs/bedfiles.c:95:17: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). len = strlen(str); data/segemehl-0.3.4/libs/bedfiles.c:123:17: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). len = strlen(str); data/segemehl-0.3.4/libs/bedfiles.c:234:24: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). ulen = strlen(pch); data/segemehl-0.3.4/libs/biofiles.c:1974:45: [1] (buffer) getc: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). while((ch = (index) ? bl_getgzidxc(gzf) : getc(fp)) != EOF) { data/segemehl-0.3.4/libs/biofiles.c:2564:43: [1] (buffer) getc: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). while((ch= (gzip) ? bl_getgzidxc(gzf) : getc(fp)) != EOF) { data/segemehl-0.3.4/libs/biofiles.c:3105:10: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). alen = strlen(a); data/segemehl-0.3.4/libs/biofiles.c:3106:10: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). blen = strlen(b); data/segemehl-0.3.4/libs/biofiles.c:3107:10: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). tlen = strlen(temp); data/segemehl-0.3.4/libs/biofiles.c:3178:8: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). if(strlen(id) <= j && strncmp(id, desc, j) == 0) { data/segemehl-0.3.4/libs/biofiles.c:3489:13: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). len = strlen(str); data/segemehl-0.3.4/libs/biofiles.c:3501:17: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). len = strlen(str); data/segemehl-0.3.4/libs/biofiles.c:3529:17: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). len = strlen(str); data/segemehl-0.3.4/libs/biofiles.c:3593:26: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). pchlen = strlen(pch); data/segemehl-0.3.4/libs/biofiles.c:3597:60: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). bl_GFFAddAttribute(space, item, &pch[p], strlen(&pch[p])); data/segemehl-0.3.4/libs/brendel.c:85:23: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). splicedaligndp (char *read, unsigned int m, char *genome, unsigned int n, gene_t **model) data/segemehl-0.3.4/libs/brendel.c:98:21: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). initAlignment(al, read, m, 0, genome, n, 0); data/segemehl-0.3.4/libs/brendel.c:138:28: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if(genome[0] != 'N' && read[v-1] != 'N') { data/segemehl-0.3.4/libs/brendel.c:139:23: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if(genome[0] == read[v-1]) t2 += 2.0; else t2 -= 2.0; data/segemehl-0.3.4/libs/brendel.c:143:90: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). double t3 = MAX(E[1][v-1] + tau_exde, I[1][v-1] + tau_inde) + splicedalignscore('-', read[v-1]); data/segemehl-0.3.4/libs/brendel.c:144:98: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). double t2 = MAX(E[0][v-1] + tau_start, I[0][v-1] + tau_start) + splicedalignscore(genome[0], read[v-1]); data/segemehl-0.3.4/libs/brendel.c:178:32: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if(genome[u-1] != 'N' && read[v-1] != 'N'){ data/segemehl-0.3.4/libs/brendel.c:179:27: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if(genome[u-1] == read[v-1]) t2 += 2.0; else t2 -= 2.0; data/segemehl-0.3.4/libs/brendel.c:183:105: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). double t2 = MAX(E[u-1][v-1] + tau_exex, I[u-1][v-1] + tau_inex) + splicedalignscore(genome[u-1], read[v-1]) ; data/segemehl-0.3.4/libs/brendel.c:184:93: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). double t3 = MAX(E[u][v-1] + tau_exde, I[u][v-1] + tau_inde) + splicedalignscore('-', read[v-1]); data/segemehl-0.3.4/libs/brendel.c:221:31: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if(genome[u-1] != 'N' && read[v-1] != 'N') { data/segemehl-0.3.4/libs/brendel.c:222:31: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). temp = (genome[u-1] == read[v-1]) ? 2.0 : -2.0; data/segemehl-0.3.4/libs/brendel.c:243:78: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if(E[u][v] == E[u-1][v-1] + tau_exex_ + splicedalignscore(genome[u-1], read[v-1])) { data/segemehl-0.3.4/libs/brendel.c:246:39: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if (matchIUPAC(genome[u-1], read[v-1])) data/segemehl-0.3.4/libs/brendel.c:275:67: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if(E[u][v] == E[u][v-1] + tau_exde + splicedalignscore('-', read[v-1])) { data/segemehl-0.3.4/libs/brendel.c:301:78: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if(E[u][v] == I[u-1][v-1] + tau_inex_ + splicedalignscore(genome[u-1], read[v-1])) { data/segemehl-0.3.4/libs/brendel.c:306:39: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if (matchIUPAC(genome[u-1], read[v-1])) data/segemehl-0.3.4/libs/brendel.c:327:68: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if(E[u][v] == I[u][v-1] + tau_inde_ + splicedalignscore('-', read[v-1])){ data/segemehl-0.3.4/libs/brendel.c:473:15: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). static char read[] = "AACCGTACTAGCATGCATACGGATAGTGGGACCGCTCCTAATACGTGTAACTAGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCACGAGATGATAATATATTCAAGTTGCCGCTAATCAGAAATAAATTCATTGCAACGTTAAATACAGCACAATATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTAATGAGTGCCTCTCGTTCTCTGTCTTATATTACCGCAAACCCAAAAACTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAAGTCGACGACCCGTAACCGTACTAGCATTTGCATACGGACAGTACGGCTCCTAATACGTGTAACTAGAAAAAAAAAA\0"; data/segemehl-0.3.4/libs/brendel.c:477:24: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). al = splicedaligndp (read, strlen(read), genome, strlen(genome), &model); data/segemehl-0.3.4/libs/brendel.c:477:30: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). al = splicedaligndp (read, strlen(read), genome, strlen(genome), &model); data/segemehl-0.3.4/libs/brendel.c:477:37: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). al = splicedaligndp (read, strlen(read), genome, strlen(genome), &model); data/segemehl-0.3.4/libs/brendel.c:477:52: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). al = splicedaligndp (read, strlen(read), genome, strlen(genome), &model); data/segemehl-0.3.4/libs/charsequence.c:58:46: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). addString(space, entries, &s->sequence[i], strlen(&s->sequence[i])); data/segemehl-0.3.4/libs/charsequence.c:82:29: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memset(&buf[pos], ' ', 5-strlen(buf2)); data/segemehl-0.3.4/libs/charsequence.c:83:13: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). pos += 5-strlen(buf2); data/segemehl-0.3.4/libs/charsequence.c:84:29: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(&buf[pos], buf2, strlen(buf2)); data/segemehl-0.3.4/libs/charsequence.c:85:11: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). pos += strlen(buf2); data/segemehl-0.3.4/libs/charsequence.c:122:44: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). addString(space, first, &a->sequence[i], strlen(&a->sequence[i])); data/segemehl-0.3.4/libs/charsequence.c:133:45: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). addString(space, second, &b->sequence[i], strlen(&b->sequence[i])); data/segemehl-0.3.4/libs/charsequence.c:179:31: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memset(&bufa[pos1], ' ', 5-strlen(nobuf)); data/segemehl-0.3.4/libs/charsequence.c:180:14: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). pos1 += 5-strlen(nobuf); data/segemehl-0.3.4/libs/charsequence.c:181:32: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(&bufa[pos1], nobuf, strlen(nobuf)); data/segemehl-0.3.4/libs/charsequence.c:182:12: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). pos1 += strlen(nobuf); data/segemehl-0.3.4/libs/charsequence.c:189:31: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memset(&bufb[pos2], ' ', 5-strlen(nobuf)); data/segemehl-0.3.4/libs/charsequence.c:190:14: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). pos2 += 5-strlen(nobuf); data/segemehl-0.3.4/libs/charsequence.c:191:32: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(&bufb[pos2], nobuf, strlen(nobuf)); data/segemehl-0.3.4/libs/charsequence.c:192:12: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). pos2 += strlen(nobuf); data/segemehl-0.3.4/libs/fileBins.c:562:64: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). dms->domain[i].domainname = ALLOCMEMORY(space, NULL, char, strlen(domainnames[i])+1); data/segemehl-0.3.4/libs/fileBins.c:563:56: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(dms->domain[i].domainname, domainnames[i], strlen(domainnames[i])); data/segemehl-0.3.4/libs/fileBins.c:564:31: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). dms->domain[i].domainname[strlen(domainnames[i])] = '\0'; data/segemehl-0.3.4/libs/fileBins.c:688:16: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). cnamelen = strlen(cname); data/segemehl-0.3.4/libs/fileBins.c:732:16: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). cnamelen = strlen(cname); data/segemehl-0.3.4/libs/fileBins.c:735:8: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). if(strlen(ccname) == 0) { data/segemehl-0.3.4/libs/fileBins.c:1029:18: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). cnamelen = strlen(cname); data/segemehl-0.3.4/libs/fileio.c:160:41: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). fname = ALLOCMEMORY(NULL, NULL, char, strlen(path) + strlen(tmp)+11); data/segemehl-0.3.4/libs/fileio.c:160:56: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). fname = ALLOCMEMORY(NULL, NULL, char, strlen(path) + strlen(tmp)+11); data/segemehl-0.3.4/libs/fileio.c:162:6: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). if(strlen(tmp) > 0) data/segemehl-0.3.4/libs/fileio.c:193:66: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). ALLOCMEMORY(space, filenamestring, char, filenamestringpos+strlen(filenames[i])+2); data/segemehl-0.3.4/libs/fileio.c:195:63: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(&filenamestring[filenamestringpos], filenames[i], strlen(filenames[i])); data/segemehl-0.3.4/libs/fileio.c:196:26: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). filenamestringpos += strlen(filenames[i]); data/segemehl-0.3.4/libs/fileio.c:203:40: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). cmd = ALLOCMEMORY(space, NULL, char, strlen(prg) + strlen(fieldstring) data/segemehl-0.3.4/libs/fileio.c:203:54: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). cmd = ALLOCMEMORY(space, NULL, char, strlen(prg) + strlen(fieldstring) data/segemehl-0.3.4/libs/fileio.c:204:9: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). + strlen(filenamestring) + strlen(outfile) + 15); data/segemehl-0.3.4/libs/fileio.c:204:34: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). + strlen(filenamestring) + strlen(outfile) + 15); data/segemehl-0.3.4/libs/fileio.c:217:16: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). cmd = calloc(strlen(prg) + strlen(filename) + 10, 1); data/segemehl-0.3.4/libs/fileio.c:217:30: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). cmd = calloc(strlen(prg) + strlen(filename) + 10, 1); data/segemehl-0.3.4/libs/fileio.c:310:9: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). suf = strlen(filename); data/segemehl-0.3.4/libs/fileio.c:311:16: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). for(i=1; i < strlen(filename); i++) { data/segemehl-0.3.4/libs/fileio.c:402:15: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). suffixlen = strlen(suffix); data/segemehl-0.3.4/libs/fileio.c:424:15: [1] (buffer) fgetc: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). while((ch = fgetc(fp)) != EOF) { data/segemehl-0.3.4/libs/fileio.c:450:15: [1] (buffer) fgetc: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). while((ch = fgetc(fp)) != EOF) { data/segemehl-0.3.4/libs/fileio.c:482:15: [1] (buffer) fgetc: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). while((ch = fgetc(fp)) != EOF) { data/segemehl-0.3.4/libs/fileio.c:511:15: [1] (buffer) fgetc: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). while((ch = fgetc(fp)) != EOF){ data/segemehl-0.3.4/libs/fileio.c:532:13: [1] (buffer) getc: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). while((ch=getc(fp)) != EOF && ch != '\n') { data/segemehl-0.3.4/libs/fileio.c:550:47: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). readfile(void* space, char* filename, size_t* strlen) { data/segemehl-0.3.4/libs/fileio.c:566:13: [1] (buffer) getc: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). while((ch=getc(fp)) != EOF) { data/segemehl-0.3.4/libs/gzidx.c:598:11: [1] (buffer) getc: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). ret = getc(fp); data/segemehl-0.3.4/libs/gzip.c:91:17: [1] (buffer) fgetc: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). while ((c = fgetc(f)) != EOF) { data/segemehl-0.3.4/libs/haarz.c:71:7: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). n = strlen(str); data/segemehl-0.3.4/libs/karlin.c:198:25: [1] (buffer) mismatch: Function does not check the second iterator for over-read conditions (CWE-126). This function is often discouraged by most C++ coding standards in favor of its safer alternatives provided since C++14. Consider using a form of this function that checks the second iterator before potentially overflowing it. ret = karlinpp(space, mismatch, match, &pr[0], lambda, K); data/segemehl-0.3.4/libs/karlin.c:202:50: [1] (buffer) mismatch: Function does not check the second iterator for over-read conditions (CWE-126). This function is often discouraged by most C++ coding standards in favor of its safer alternatives provided since C++14. Consider using a form of this function that checks the second iterator before potentially overflowing it. *H = (*lambda * match * targetid) + (*lambda * mismatch * (1-targetid)); data/segemehl-0.3.4/libs/manopt.c:58:16: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). src = calloc(strlen(version)+1, sizeof(char)); data/segemehl-0.3.4/libs/manopt.c:62:19: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(p,p+strlen(subs[i]), strlen(p+strlen(subs[i]))+1); data/segemehl-0.3.4/libs/manopt.c:62:36: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(p,p+strlen(subs[i]), strlen(p+strlen(subs[i]))+1); data/segemehl-0.3.4/libs/manopt.c:62:45: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(p,p+strlen(subs[i]), strlen(p+strlen(subs[i]))+1); data/segemehl-0.3.4/libs/manopt.c:73:14: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). p = calloc(strlen(version)+strlen(revision)+strlen(time)+3, sizeof(char)); data/segemehl-0.3.4/libs/manopt.c:73:30: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). p = calloc(strlen(version)+strlen(revision)+strlen(time)+3, sizeof(char)); data/segemehl-0.3.4/libs/manopt.c:73:47: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). p = calloc(strlen(version)+strlen(revision)+strlen(time)+3, sizeof(char)); data/segemehl-0.3.4/libs/manopt.c:75:5: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). p[strlen(version)]=' '; data/segemehl-0.3.4/libs/manopt.c:76:13: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(p+strlen(version)+1, revision, strlen(revision)); data/segemehl-0.3.4/libs/manopt.c:76:42: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(p+strlen(version)+1, revision, strlen(revision)); data/segemehl-0.3.4/libs/manopt.c:77:5: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). p[strlen(version)+strlen(revision)+1]=' '; data/segemehl-0.3.4/libs/manopt.c:77:21: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). p[strlen(version)+strlen(revision)+1]=' '; data/segemehl-0.3.4/libs/manopt.c:78:13: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(p+strlen(version)+strlen(revision)+2, time, strlen(time)); data/segemehl-0.3.4/libs/manopt.c:78:29: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(p+strlen(version)+strlen(revision)+2, time, strlen(time)); data/segemehl-0.3.4/libs/manopt.c:78:55: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(p+strlen(version)+strlen(revision)+2, time, strlen(time)); data/segemehl-0.3.4/libs/manopt.c:79:5: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). p[strlen(version)+strlen(revision)+strlen(time)+2] =0; data/segemehl-0.3.4/libs/manopt.c:79:21: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). p[strlen(version)+strlen(revision)+strlen(time)+2] =0; data/segemehl-0.3.4/libs/manopt.c:79:38: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). p[strlen(version)+strlen(revision)+strlen(time)+2] =0; data/segemehl-0.3.4/libs/manopt.c:94:11: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). int len=strlen(s); data/segemehl-0.3.4/libs/manopt.c:106:11: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). int len=strlen(s); data/segemehl-0.3.4/libs/manopt.c:153:3: [1] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant character. strcat(call, " "); data/segemehl-0.3.4/libs/manopt.c:154:13: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). calllen = strlen(call); data/segemehl-0.3.4/libs/manopt.c:156:5: [1] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant character. strcat(synopsis, "\n"); data/segemehl-0.3.4/libs/manopt.c:185:7: [1] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant character. strcat(arg[aptr], "]"); data/segemehl-0.3.4/libs/manopt.c:192:9: [1] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant character. strcat(synopsis, "["); data/segemehl-0.3.4/libs/manopt.c:196:9: [1] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant character. strcat(arg[aptr], " "); data/segemehl-0.3.4/libs/manopt.c:197:9: [1] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant character. strcat(synopsis, "-"); data/segemehl-0.3.4/libs/manopt.c:198:9: [1] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant character. strcat(arg[aptr], "-"); data/segemehl-0.3.4/libs/manopt.c:204:11: [1] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant character. strcat(arg[aptr], ","); data/segemehl-0.3.4/libs/manopt.c:217:9: [1] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant character. strcat(arg[aptr], " "); data/segemehl-0.3.4/libs/manopt.c:219:9: [1] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant character. strcat(synopsis, " "); data/segemehl-0.3.4/libs/manopt.c:222:7: [1] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant character. strcat(arg[aptr], " "); data/segemehl-0.3.4/libs/manopt.c:228:9: [1] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant character. strcat(msg[aptr], ")"); data/segemehl-0.3.4/libs/manopt.c:236:9: [1] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant character. strcat(synopsis, "\t"); data/segemehl-0.3.4/libs/manopt.c:241:7: [1] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant character. strcat(arg[aptr], " "); data/segemehl-0.3.4/libs/manopt.c:242:7: [1] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant character. strcat(arg[aptr], "-"); data/segemehl-0.3.4/libs/manopt.c:249:7: [1] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant character. strcat(arg[aptr], " "); data/segemehl-0.3.4/libs/manopt.c:257:5: [1] (buffer) strcat: Does not check for buffer overflows when concatenating to destination [MS-banned] (CWE-120). Consider using strcat_s, strncat, strlcat, or snprintf (warning: strncat is easily misused). Risk is low because the source is a constant character. strcat(synopsis, "\t"); data/segemehl-0.3.4/libs/manopt.c:265:17: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). synopsislen = strlen(synopsis); data/segemehl-0.3.4/libs/manopt.c:271:55: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). j < ((k+1)*(width-calllen))-1-offset && j < strlen(synopsis); j++) { data/segemehl-0.3.4/libs/manopt.c:277:17: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). restlen = strlen(&synopsis[lastspace+1]); data/segemehl-0.3.4/libs/manopt.c:283:18: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). for(j=0; j < strlen(synopsis);j++) { data/segemehl-0.3.4/libs/manopt.c:286:19: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). restlen = strlen(&synopsis[j+1]); data/segemehl-0.3.4/libs/manopt.c:294:18: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). for(k=0; k < strlen(synopsis); k++) { data/segemehl-0.3.4/libs/manopt.c:300:17: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). maxarglen = strlen(arg[i]) > maxarglen ? strlen(arg[i]) : maxarglen; data/segemehl-0.3.4/libs/manopt.c:300:46: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). maxarglen = strlen(arg[i]) > maxarglen ? strlen(arg[i]) : maxarglen; data/segemehl-0.3.4/libs/manopt.c:311:16: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). if((msglen=strlen(msg[i])) > width-maxarglen) { data/segemehl-0.3.4/libs/manopt.c:316:59: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). j < ((k+1)*(width-maxarglen))-1-offset && j < strlen(msg[i]) data/segemehl-0.3.4/libs/manopt.c:324:19: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). restlen = strlen(&msg[i][lastspace+1]); data/segemehl-0.3.4/libs/manopt.c:331:20: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). for(j=0; j < strlen(msg[i]); j++) { data/segemehl-0.3.4/libs/manopt.c:333:20: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). restlen = strlen(&msg[i][j+1]); data/segemehl-0.3.4/libs/manopt.c:347:28: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). for(j=0; j < maxarglen-strlen(arg[i]); j++) { data/segemehl-0.3.4/libs/manopt.c:468:13: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). len = strlen(&argv[i][offset+1])+1; data/segemehl-0.3.4/libs/manopt.c:689:17: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). } else if(strlen(argset->args[arg].values[0]) > 1) { data/segemehl-0.3.4/libs/manopt.c:1075:42: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). || (set->opts[i].shortopt && strlen(argset.args[j].flagname)==1 && data/segemehl-0.3.4/libs/manout.c:690:14: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). buffer[strlen(buffer)-1]=29; data/segemehl-0.3.4/libs/manout.c:789:45: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). bl_freplacestr(info->outfn, buffer, strlen(buffer), '\n'); data/segemehl-0.3.4/libs/manout.c:827:11: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). strlen(info->filebinbasename), "sam", 3, header, 1); data/segemehl-0.3.4/libs/mapfrag.c:639:15: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). l->seqlen = strlen(seq); data/segemehl-0.3.4/libs/mapfrag.c:2822:19: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). Uint queryidlen=strlen(queryname); data/segemehl-0.3.4/libs/mapfrag.c:2829:40: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item = ALLOCMEMORY(NULL, NULL, char, strlen(basename)+4+queryidlen+3); data/segemehl-0.3.4/libs/mapfrag.c:2830:27: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(item, basename, strlen(basename)); data/segemehl-0.3.4/libs/mapfrag.c:2831:8: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item[strlen(basename)] = sep; data/segemehl-0.3.4/libs/mapfrag.c:2883:12: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item[strlen(basename)+1] = 'R'; data/segemehl-0.3.4/libs/mapfrag.c:2884:12: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item[strlen(basename)+2] = sep; data/segemehl-0.3.4/libs/mapfrag.c:2885:21: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(&item[strlen(basename)+3], queryid, queryidlen); data/segemehl-0.3.4/libs/mapfrag.c:2886:12: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item[strlen(basename)+3+queryidlen] = sep; data/segemehl-0.3.4/libs/mapfrag.c:2887:12: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item[strlen(basename)+3+queryidlen+1] = (ismate) ? '2' : '1' ; data/segemehl-0.3.4/libs/mapfrag.c:2888:12: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item[strlen(basename)+3+queryidlen+2] = '\0'; data/segemehl-0.3.4/libs/mapfrag.c:2929:20: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item[strlen(basename)+1] = 'C'; data/segemehl-0.3.4/libs/mapfrag.c:2931:20: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item[strlen(basename)+1] = 'B'; data/segemehl-0.3.4/libs/mapfrag.c:2934:18: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item[strlen(basename)+2] = sep; data/segemehl-0.3.4/libs/mapfrag.c:2935:27: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(&item[strlen(basename)+3], queryid, queryidlen); data/segemehl-0.3.4/libs/mapfrag.c:2936:18: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item[strlen(basename)+3+queryidlen] = sep; data/segemehl-0.3.4/libs/mapfrag.c:2937:18: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item[strlen(basename)+3+queryidlen+1] = (ismate) ? '2' : '1' ; data/segemehl-0.3.4/libs/mapfrag.c:2938:18: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item[strlen(basename)+3+queryidlen+2] = '\0'; data/segemehl-0.3.4/libs/mapfrag.c:2973:20: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item[strlen(basename)+1] = 'C'; data/segemehl-0.3.4/libs/mapfrag.c:2975:20: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item[strlen(basename)+1] = 'B'; data/segemehl-0.3.4/libs/mapfrag.c:2978:18: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item[strlen(basename)+2] = sep; data/segemehl-0.3.4/libs/mapfrag.c:2979:27: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(&item[strlen(basename)+3], queryid, queryidlen); data/segemehl-0.3.4/libs/mapfrag.c:2980:18: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item[strlen(basename)+3+queryidlen] = sep; data/segemehl-0.3.4/libs/mapfrag.c:2981:18: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item[strlen(basename)+3+queryidlen+1] = (ismate) ? '2' : '1' ; data/segemehl-0.3.4/libs/mapfrag.c:2982:18: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). item[strlen(basename)+3+queryidlen+2] = '\0'; data/segemehl-0.3.4/libs/mappingqual.c:213:13: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). len = strlen(qual); data/segemehl-0.3.4/libs/mappingqual.c:435:16: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). noofeops = strlen(eopstring); data/segemehl-0.3.4/libs/mappingqual.c:550:13: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). len = strlen(qual); data/segemehl-0.3.4/libs/md5.c:75:50: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). md5_append(&state, (const md5_byte_t *)test[i], strlen(test[i])); data/segemehl-0.3.4/libs/merge.c:143:14: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if (entry->read != NULL){ data/segemehl-0.3.4/libs/merge.c:144:27: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). bl_samDestruct(entry->read); data/segemehl-0.3.4/libs/merge.c:145:29: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). FREEMEMORY(NULL, entry->read); data/segemehl-0.3.4/libs/merge.c:208:18: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if (list[i]->read != NULL){ data/segemehl-0.3.4/libs/merge.c:217:37: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). bl_samDestruct(list[i]->read); data/segemehl-0.3.4/libs/merge.c:218:39: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). FREEMEMORY(NULL, list[i]->read); data/segemehl-0.3.4/libs/merge.c:225:44: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). bl_samDestruct(list[bestread]->read); data/segemehl-0.3.4/libs/merge.c:226:46: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). FREEMEMORY(NULL, list[bestread]->read); data/segemehl-0.3.4/libs/merge.c:232:59: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). cmp = bl_mergeCompareUnmapped(list[bestread]->read, list[i]->read); data/segemehl-0.3.4/libs/merge.c:232:74: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). cmp = bl_mergeCompareUnmapped(list[bestread]->read, list[i]->read); data/segemehl-0.3.4/libs/merge.c:234:39: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). bl_samDestruct(list[i]->read); data/segemehl-0.3.4/libs/merge.c:235:41: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). FREEMEMORY(NULL, list[i]->read); data/segemehl-0.3.4/libs/merge.c:239:46: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). bl_samDestruct(list[bestread]->read); data/segemehl-0.3.4/libs/merge.c:240:48: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). FREEMEMORY(NULL, list[bestread]->read); data/segemehl-0.3.4/libs/merge.c:306:18: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if (list[i]->read != NULL){ data/segemehl-0.3.4/libs/merge.c:332:18: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if (list[i]->read != NULL && list[i]->mate != NULL){ data/segemehl-0.3.4/libs/merge.c:333:42: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). edist = atoi(bl_samgetTag(list[i]->read, "NM")->val); data/segemehl-0.3.4/libs/merge.c:342:18: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if (list[i]->read != NULL && list[i]->mate != NULL){ data/segemehl-0.3.4/libs/merge.c:343:42: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). edist = atoi(bl_samgetTag(list[i]->read, "NM")->val); data/segemehl-0.3.4/libs/merge.c:346:33: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). bl_samDestruct(list[i]->read); data/segemehl-0.3.4/libs/merge.c:347:35: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). FREEMEMORY(NULL, list[i]->read); data/segemehl-0.3.4/libs/merge.c:370:18: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if (list[i]->read != NULL && !(list[i]->read->flag & 0x4)){ data/segemehl-0.3.4/libs/merge.c:371:42: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). edist = atoi(bl_samgetTag(list[i]->read, "NM")->val); data/segemehl-0.3.4/libs/merge.c:384:18: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if (list[i]->read != NULL && !(list[i]->read->flag & 0x4)){ data/segemehl-0.3.4/libs/merge.c:385:42: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). edist = atoi(bl_samgetTag(list[i]->read, "NM")->val); data/segemehl-0.3.4/libs/merge.c:387:33: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). bl_samDestruct(list[i]->read); data/segemehl-0.3.4/libs/merge.c:388:35: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). FREEMEMORY(NULL, list[i]->read); data/segemehl-0.3.4/libs/merge.c:415:18: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). tmpiread = (i->read != NULL) && !(i->read->flag & 0x4); data/segemehl-0.3.4/libs/merge.c:417:18: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). tmpjread = (j->read != NULL) && !(j->read->flag & 0x4); data/segemehl-0.3.4/libs/merge.c:540:52: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). if (! bl_mergefileFastaIDCompare(entry->qname, strlen(entry->qname), data/segemehl-0.3.4/libs/merge.c:541:23: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). rec->qname, strlen(rec->qname)) || data/segemehl-0.3.4/libs/merge.c:551:16: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if (entry->read != NULL){ data/segemehl-0.3.4/libs/merge.c:589:11: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). len = strlen(file->buffer); data/segemehl-0.3.4/libs/merge.c:604:17: [1] (buffer) getc: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). while((ch = getc(file->fp)) != EOF) { data/segemehl-0.3.4/libs/merge.c:631:21: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). assert(len == strlen(buffer)); data/segemehl-0.3.4/libs/merge.c:721:18: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if (list[i]->read != NULL && !(list[i]->read->flag & 0x4)){ data/segemehl-0.3.4/libs/merge.c:743:18: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if (list[i]->read != NULL){ data/segemehl-0.3.4/libs/merge.c:870:18: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if (best[j]->read != NULL){ data/segemehl-0.3.4/libs/merge.c:874:34: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). bl_mergeUpdateTag(best[j]->read, q++, noofqueries); data/segemehl-0.3.4/libs/merge.c:885:17: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). if(best[j]->read != NULL){ data/segemehl-0.3.4/libs/merge.c:896:40: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). bl_samprintSamrec(fp, best[j]->read, '\n'); data/segemehl-0.3.4/libs/merge.c:899:50: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). bl_bamPrintBamrec (nfo->bamdev, best[j]->read, nfo->bamhdr, write_mtx); data/segemehl-0.3.4/libs/merge.c:1115:24: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). curlen = strlen(curkey); data/segemehl-0.3.4/libs/merge.c:1126:22: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). curlen = strlen(curkey); data/segemehl-0.3.4/libs/merge.c:1130:43: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). files->f[j].entry->qname, strlen(files->f[j].entry->qname))){ data/segemehl-0.3.4/libs/samheader.c:166:18: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). sprintf(&hdr[strlen(hdr)-1], "%c", 29); data/segemehl-0.3.4/libs/samheader.c:512:43: [1] (buffer) getc: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). while((ch= (gzip) ? bl_getgzidxc(gzf) : getc(fp)) != EOF) { data/segemehl-0.3.4/libs/samio.c:82:11: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). len = strlen(qname); data/segemehl-0.3.4/libs/samio.c:333:50: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). set = tokensToStringset(NULL, ",", tag->val, strlen(tag->val)); data/segemehl-0.3.4/libs/samio.c:461:50: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). set = tokensToStringset(NULL, ",", tag->val, strlen(tag->val)); data/segemehl-0.3.4/libs/samio.c:532:25: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). Uint tmplen = strlen(tmp); data/segemehl-0.3.4/libs/samio.c:533:22: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). Uint len = strlen(rec->tags[rec->nooftags].val); data/segemehl-0.3.4/libs/samio.c:792:10: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). ulen = strlen(seq); data/segemehl-0.3.4/libs/samio.c:925:39: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). samrec->qual=strrev(samrec->qual, strlen(samrec->qual)); data/segemehl-0.3.4/libs/samio.c:1076:49: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). char *tmp = concat(NULL, left, myseq, myll, strlen(myseq)); data/segemehl-0.3.4/libs/samio.c:1080:50: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). tmp = concat(NULL, leftqual, myqual, myll, strlen(myqual)); data/segemehl-0.3.4/libs/samio.c:1087:40: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). myseq = concat(NULL, myseq, right, strlen(myseq), myrr); data/segemehl-0.3.4/libs/samio.c:1090:48: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). myqual = concat(NULL, myqual, rightqual, strlen(myqual), myrr); data/segemehl-0.3.4/libs/samio.c:1651:34: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). bl_reconvertBisulfite(seq, strlen(seq), nfo->bisulfite); data/segemehl-0.3.4/libs/segemehl.c:167:17: [1] (buffer) getchar: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). while((ch=getchar()) != 'n' && ch != 'y'); data/segemehl-0.3.4/libs/segemehl.c:170:19: [1] (buffer) getchar: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). while((ch=getchar()) != 'n' && ch != 'y'); data/segemehl-0.3.4/libs/segemehl.c:180:17: [1] (buffer) getchar: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). while((ch=getchar()) != 'n' && ch != 'y'); data/segemehl-0.3.4/libs/segemehl.c:183:19: [1] (buffer) getchar: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). while((ch=getchar()) != 'n' && ch != 'y'); data/segemehl-0.3.4/libs/segemehl.c:192:30: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). nfo->softclip3PrimeLen = strlen(nfo->softclip3Prime); data/segemehl-0.3.4/libs/segemehl.c:196:30: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). nfo->softclip5PrimeLen = strlen(nfo->softclip5Prime); data/segemehl-0.3.4/libs/segemehl.c:241:21: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). qfbaselen = strlen(qfbase); data/segemehl-0.3.4/libs/segemehl.c:247:28: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). filebinbasenamelen = strlen(nfo->filebinbasename); data/segemehl-0.3.4/libs/segemehl.c:795:21: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). qfbaselen = strlen(qfbase); data/segemehl-0.3.4/libs/segemehl.c:802:28: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). filebinbasenamelen = strlen(info.filebinbasename); data/segemehl-0.3.4/libs/seqclip.c:194:16: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). polyAlen = strlen(polyA) + clen; data/segemehl-0.3.4/libs/seqclip.c:197:30: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(polyAseq, polyA, strlen(polyA)); data/segemehl-0.3.4/libs/seqclip.c:198:23: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). memmove(&polyAseq[strlen(polyA)], clp, clen); data/segemehl-0.3.4/libs/seqclip.c:201:16: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). polyAlen = strlen(polyA); data/segemehl-0.3.4/libs/seqclip.c:527:21: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). if(adapterlen < strlen(seq2)) { data/segemehl-0.3.4/libs/seqclip.c:531:20: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). adapterlen = strlen(seq2); data/segemehl-0.3.4/libs/splitalign.c:157:9: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). len = strlen(cigar); data/segemehl-0.3.4/libs/stringutils.c:46:17: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). assert(end <= strlen(seq)); data/segemehl-0.3.4/libs/stringutils.c:135:13: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). toklen = strlen(token); data/segemehl-0.3.4/libs/stringutils.c:366:2: [1] (buffer) strncpy: Easily used incorrectly; doesn't always \0-terminate or check for invalid pointers [MS-banned] (CWE-120). strncpy(new, str, l); data/segemehl-0.3.4/libs/stringutils.c:368:2: [1] (buffer) strncat: Easily used incorrectly (e.g., incorrectly computing the correct maximum size to add) [MS-banned] (CWE-120). Consider strcat_s, strlcat, snprintf, or automatically resizing strings. strncat(new, ext, m); data/segemehl-0.3.4/libs/stringutils.c:386:2: [1] (buffer) strncpy: Easily used incorrectly; doesn't always \0-terminate or check for invalid pointers [MS-banned] (CWE-120). strncpy(new, path, m); data/segemehl-0.3.4/libs/stringutils.c:388:2: [1] (buffer) strncat: Easily used incorrectly (e.g., incorrectly computing the correct maximum size to add) [MS-banned] (CWE-120). Consider strcat_s, strlcat, snprintf, or automatically resizing strings. strncat(new, str, l); data/segemehl-0.3.4/libs/stringutils.c:389:2: [1] (buffer) strncat: Easily used incorrectly (e.g., incorrectly computing the correct maximum size to add) [MS-banned] (CWE-120). Consider strcat_s, strlcat, snprintf, or automatically resizing strings. strncat(new, ext, n); data/segemehl-0.3.4/libs/stringutils.c:470:23: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). char *d = malloc (strlen (s) + 1); // Allocate memory data/segemehl-0.3.4/libs/stringutils.c:530:11: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). cur = strlen(cpy); data/segemehl-0.3.4/libs/stringutils.c:550:11: [1] (buffer) strlen: Does not handle strings that are not \0-terminated; if given one it may perform an over-read (it could cause a crash if unprotected) (CWE-126). cur = strlen(cpy); data/segemehl-0.3.4/libs/sufarray.c:581:9: [1] (buffer) fgetc: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). op = fgetc(stdin); data/segemehl-0.3.4/libs/sufarray.c:757:14: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). nbytes = read(s->fd, &ch, sizeof(signed char)); data/segemehl-0.3.4/libs/sufarray.c:1018:14: [1] (buffer) read: Check buffer boundaries if used in a loop including recursive loops (CWE-120, CWE-20). nbytes = read(s->fd, &base, sizeof(Uint)); ANALYSIS SUMMARY: Hits = 580 Lines analyzed = 55627 in approximately 1.41 seconds (39359 lines/second) Physical Source Lines of Code (SLOC) = 35273 Hits@level = [0] 471 [1] 281 [2] 226 [3] 2 [4] 71 [5] 0 Hits@level+ = [0+] 1051 [1+] 580 [2+] 299 [3+] 73 [4+] 71 [5+] 0 Hits/KSLOC@level+ = [0+] 29.7962 [1+] 16.4432 [2+] 8.47674 [3+] 2.06957 [4+] 2.01287 [5+] 0 Dot directories skipped = 1 (--followdotdir overrides) Minimum risk level = 1 Not every hit is necessarily a security vulnerability. There may be other security vulnerabilities; review your code! See 'Secure Programming HOWTO' (https://dwheeler.com/secure-programs) for more information.